Luonnon oma GMO eli DNA goes retro II

”Perinnöllisen dna:n siirtyminen lajista toiseen on luonnotonta”? Ei ole. Esimerkiksi bakteereilla dna:n siirtyminen lajista toiseen siirtyminen on arkipäivää. Antibiootille vastustuskykyinen bakteeri voi syntyä, kun yksi laji nappaa toiselta lajilta dna:ta, jossa on sopiva geeni.

Dna:n siirtymistä lajista toiseen tapahtuu monisoluisilla eläimilläkin. Uuden tutkimuksen mukaan neljäsosa (!) lehmän ja muiden märehtijöiden perimästä saattaa olla alunperin lähtöisin käärmeiden dna:sta (Walsh ym. 2013).

Samaa dna:ta käärmeessä, lehmässä, pussiliito-oravassa, tamaanissa, vesinokkaeläimessä ja...? Kuva: Walsh ym. 2013. Huomaa pieni huolimattomuus: tutkijoiden omia koodeja on unohtunut joihinkin oksan haaroihin (BovB_ACo, RTE1X_SP...).

Samaa dna:ta käärmeessä, lehmässä, pussiliito-oravassa, tamaanissa, vesinokkaeläimessä ja…? Kuva: Walsh ym. 2013 (pieni moka kuvassa, tutkijoiden omia koodeja on unohtunut joidenkin lajinimien eteen).

Samanlaisen dna:n löytyminen käärmeistä ja lehmistä ei tarkoita, että käärmeen omia geenejä tai mitään muita käärmeille tarpeellisia dna:n osia olisi tässä tapauksessa siirtynyt lehmään, tai päinvastoin. Itse asiassa, käärmeet sen paremmin kuin lehmätkään eivät tee tällä dna:lla yhtään mitään.

Mitä kummaa dna:ta sitten on siirtynyt käärmeestä lehmään? Mitä on siirtynyt nahkiaisesta kaloihin, joissa nahkiainen loisii (Kuraku ym. 2012)? Mikä on space invader -avaruushyökkääjä, jonka kopioita on oudosti puoliapinoiden, jyrsijöiden, lepakoiden, tanrekkien, pussieläinten, liskojen ja sammakoiden perimässä (Pace ym. 2008)?

Näissä invaasioissa on kyse ”itsekkäästä” dna:sta, transposoneista, dna:n palasista, jotka yleensä kopioituvat dna:ssa lajin sisäisesti, mutta onnistuvat joskus loikkaamaan eliölajista toiseen.

Käärmeelle ja lehmälle yhteinen transposoni on tarkemmin sanottuna retrotransposoni tai lyhyemmin retroelementti. Retroelementit kopioituvat rna-välivaiheen kautta. Ilmeisesti tämä rna voi siirtyä lajista toiseen kun esimerkiksi punkki puree ensin käärmettä ja sitten lehmää, tai kun nahkiainen pureutuu kalaan.

Eläinten perimässä on geenejä, joiden avulla rna kopioituu takaisin dna:ksi ja voi tulla liitetyksi mukaan seuraaviin sukupolveen periytyvään dna:han. Kyseiset geenit puolestaan ovat eläimen perimään jo aiemmin pesäpaikkansa tehneiden retroelementtien geenejä.

Kun retroelementin dna on hypännyt lajista toiseen, se voi alkaa kopioutua uudessa ympäristössään – tai sitten ei. Ihan mitä tahansa perimän dna:ta ei tietenkään käännetä rna:ksi, vaan kääntäminen vaatii oikeanlaiset tunnistus- ja säätelyjaksot ympärilleen.

Walsh ym. (2013) löysivät geenipankkia seuloessaan BovB-nimisiä retroelementtejä oudosti jakaantuneena eläinryhmiin, jotka eivät ole toisilleen erityisen läheistä sukua: käärmeistä, liskoista, pussieläimistä, nokkaeläimistä, norsuista ja sen sukulaisista ja hevosista.  Joissain eläinryhmissä nämä retroelementit ovat älyttömän yleisiä ja joissain harvinaisia.

Nerokas veto oli tutkia, löytyisikö kyseisiä retroelementtejä punkeista, jotka purevat sekä matelijoita, että nisäkkäitä ja voisivat näin toimia välittäjinä elementtien hypätessä lajista toisiin – ja löytyihän niitä myös punkeista.

Kaunista; hullun lailla kopioituvaa geenipätkää on siellä täällä eläinryhmissä, jotka eivät ole toisilleen sukua ja samaa geenipätkää on myös punkeilla, jotka purevat näitä eläimiä.

Tapaus selvitetty? Ei ihan, sellainen kauneusvirhe teoriassa on, että retroelementtejä löytyi vähän turhankin laajasti eläinkunnasta, myös lajeilta, joita on aika vaikea linkittää punkinpuremateoriaan: merisiilien ja silkkiperhosen perimässäkin näyttäisi olevan BovB-elementtejä. Mitä pirua ne siellä tekevät?

Snake and ticks - käärme ja punkkeja

Amblyomma-suvun punkkeja tunkemassa pytonin suomujen alle. Kuva © Eric Vanderduys 2012. Julkaistu kuvaajan luvalla.

Miksi sitten BovB-retroelementti on lähtenyt kopioitumaan hullun lailla märehtijöissä ja suomumatelijoissa, mutta ei muissa eläinryhmissä, joissa sitä kuitenkin todistettavasti on. Tähän tutkijoilla ei ole hypoteesia. Minulla on!

Hypoteesiini liittyvät lyhyet retroelementit, märehtijöiden BovA-sukuiset ja matelijoiden CR1 sinet. Nyt juttu menee kuitenkin jo sen verran tekniseksi ja yksityiskohtaiseksi, että taitaa olla laittaa aiheen tarkempi märehtiminen kommentteihin  jonkun tosi innostuneen genetiikkanörtin löydettäväksi (voisi muutan olla ihan julkaisukelpoista kamaa edelleen tämä…).

Viitteet:

Kolkkala, M. 2000: Retroposonit märehtijöiden perimässä. Pro gradu. Helsingin yliopisto. Yritin lyödä läpi retrotransposonille vähän lyhyempää nimeä retroposoni. Termiä ”retroposon” käytettiin joissain vanhoissa artikkeleissakin, tosin vähän kirjavassa merkityksessä. Mutta mihinkä se ehdotus yhdestä gradusta etenisi, olisi pitänyt jaksaa tehdä oma tieteellinen artikkeli.

Kuraku, S. Qiu, H ja Meyer, A. 2012: Horizontal transfers of Tc1 elements between teleost fishes and their vertebrate parasites, lampreys. Genome Biol. Evol. 4: 929-936

Pace, J. K., Gilbert, C., Clark, M. S. ja Feschotte, C. 2008: Repeated horizontal transfer of a DNA transposon in mammals and other tetrapods. Proc. Natl. Acad. Sci. 105: 17023-17028

Walsh, A. M., Kortschak, R. D., Gardner, M. G., Bertozzi, T. ja Adelson, D. L. 2013: Widespread horizontal transfer of retrotransposons. Proc. Natl. Acad. Sci. 110: 1012-1016

6 vastausta artikkeliin: Luonnon oma GMO eli DNA goes retro II

  1. nopoles kirjoitti:

    Miksi BovB-retrotransposoni on monistunut juuri märehtijöiden ja suomumatelijoiden perimässä tuhansiksi kopioiksi?

    Märehtijöiden BovB LINEille (= long interspersed elements) tunnusomainen on lyhyt DNA-pätkä nimeltä BovA, jonka palasia löytyy BovB-LINEjen päistä.  BovA puolestaan on olennainen osa märehtijöiden lyhyitä retroelementtejä BovtA ja BovA2 SINEjä (short interspersed elements). 

    Märehtijöiden perimässä yleisen BovA:n alkuperä on tuntematon, mutta siinä on mukana pitkä niin sanottu palindromijakso ja sen mahdollinen sekundaarirakenne muistuttaa tRNA-molekyylien apilanlehtirakennetta (Kolkkala 2000). Sekundaarirakenteen ansiosta on mahdollista, että BovA toimii itse omana alukkeenaan entsyymille, joka kääntää RNA:n tietoa takaisin DNA:ksi.

    Märehtijöiden BovtA ja BovA2 -SINEjen BovA-osat ovat myös paljon muuntelevampia kuin BovB-linen BovA-osat (Kolkkala 2000). Vaikuttaa siis siltä, että BovA-sukuiset SINEt kopioituvat perimässä jo kauan ennen kuin BovB-LINE liittyi kopioitujien joukkoon mukaan. 

    BovB-LINE on yleinen myös suomumatelijoiden (Squamata) perimässä (Walsh ym. 2013). Toisin kuin märehtijöillä, suomumatelijoiden BovB-ssä ei ole BovA-sukuisia osia, eikä BovA:ta ole missään muuallakaan koko suomumatelijoiden perimässä (löysin geenipankista yhden poikkeuksen, mutta epäilen siinä sekvensointivirhettä).

    BovA:n sijaan suomumatelijoiden dna:ssa on runsaasti toista lyhyttä retroelementtiä, SINEä nimeltä CR1 (Chicken Repeat 1) ja – kas kummaa – CR1:n palasia löytyy matelijoiden BovB-linejen molemmista päistä, aivan vastaavasti kuin BovA:n puolikkaat löytyvät märehtijöiden BovB:n päistä.

    Hypoteesini on tämä: BovB-line lähti kopioitumaan märehtijöiden perimässä vauhdilla, kun sellainen sattui osumaan keskelle tehokkaasti kopioituvaa BovA-sukuista SINEä. Vastaavasti, matelijoiden perimässä vastaavasti BovB-LINEe aloitti hurjan leviämistahtinsa, kun sellainen sattui osumaan keskelle tehokkaasti kopioituvaa CR1-SINEä. 

    SINEt eivät siis näissä tapauksissa olisi syntyneet lineistä lyhentymällä, kuten yleensä oletetaan, vaan päinvastoin, SINEt kopiotuivat perimssä ensin ja tehostivat niihin myöhemmin yhdistyneiden linejen kopiotumismekanismia. Kopioitumisen tehostumisen syynä on mahdollisesti sinejen palindromijakso, jonka ansiosta sineen liittyneen BovB-LINEn RNA-kopion päät voivat pariutua itsensä kanssa ja näin mahdollisesti toimia omana alukkeenaan käänteiskopiontientsyymille.

    Viitteet:

    Kolkkala, M. 2000: Retroposonit märehtijöiden perimässä. Pro gradu. Helsingin yliopisto.

    Walsh, A. M., Kortschak, R. D., Gardner, M. G., Bertozzi, T. ja Adelson, D. L. 2013: Widespread horizontal transfer of retrotransposons. Proc. Natl. Acad. Sci. 110: 1012-1016

  2. JV kirjoitti:

    Kiitosia näistä mielenkiintoisista jutuista. Mitä tulee ”retrobosoni” -termin käyttöön suosittelisin asiaomaisia luomaan kyseisellä nimellä artikkelin suomenkieliseen wikipediaa. Suomenkilisestä wikipedia ko. artikkeli vielä puuttuu kokonaan ja näin kyseinen lyhyempi ja siten parempi termi voisi vielä lyödä läpi.

  3. nopoles kirjoitti:

    Kiitos kiittämisestä, hyvä jos juttujani luetaan!

    Enpä ole wikiartikkelia ikinä kirjoittanut, pitääpä harkita.

    Katson miten englanninkielinen wiki määrittelee retroposonin ja retrotransposonin eron: ”in contrast to retrotransposons, they [retroposons] never encode reverse transcriptase

    Tuo määritelmä tarkoittaisi minusta, että SINEt olisivat retroposoneja, LINEt eivät.

    Perusteellisempia määrittelyjä löysin täältä: http://chemistryolife.blogspot.fi/2007/12/retrotransposons.html

    SINEjä ja LINEjen kaikkia kopioita voisi tuon mukaan sanoa rauhassa retroposoneiksi, vain ne originaalit, missä on toimiva käänteiskopointigeeni olisivat retrotransposoneja.

    Alunperin retroposonilla on ilmeisesti yritetty tarkoittaa samaa kuin ”non-long terminal repeat (non-LTR) retrotransposon” erotukseksi LTR-retrotransposoneista, jotka ovat jo melkein retroviruksia. Nämä ovat jo sellaista sanasoppaa, että lyhyt termi olisi tosiaan paikoillaan.

    Termeistä keskusteltiin vielä 1997: ”Some authors use the term ’retrotransposon’ for LTR-containing elements and “retroposon” for non-LTR elements. Other authors, as we do in this paper, use the term ’retrotransposon’ for all of them”.
    http://mbe.oxfordjournals.org/content/14/11/1145.full.pdf

    Myöhemmin retrotransposoni on lyönyt läpi yleisterminä, vaikka menee siinä englanninkielistenkin kieli solmuun.

  4. nopoles kirjoitti:

    Blogikeskustelua

    Jouto-dna:n satunnaista perusluonnetta (tai ”itsekkyyttä”) kuvaa minusta hienosti tutkimustulos, jonka mukaan neljäsosa lehmän perimästä on peräisin käärmeeltä. Käärmeestä ei ole siirtynyt lehmään hyödyllisiä geenejä tai säätelyalueita, vaan alunperin vain yksi pieni retrotransposoniksi (kuka keksii sille hyvän suomennoksen?) kutsuttu itseään kopioivan dna:n pala.

    Todennäköinen skenaario on, että jostain suomumatelijasta on aikanaan hypännyt (mahdollisesti verta imevän punkin välittämänä) retrotransposoni märehtijään. Märehtijän perimässä ei ole ollut valmiina mitään mekanismia, mikä jarruttaisi uuden itseään kopioivan dna:n leviämistä perimän sisällä.

    Vaikea todistaa, mutta pidän mahdollisena, että eliölajeja on kuollut sukupuuttoon itsekkään dna:n takia. Jos rajoittavaa mekanismia, mihin luonnonvalinta voisi tarttua ei satu ajoissa syntymään, mikään ei hillitse itsekkään dna:n kopioitumista. Silloin nimitys roska-dna:kin olisi ihan oikeutettu, toiminnallinen osa dna:ta tukahtuu roskaan.

    (Ihan sivuhuomautuksena: En tiedä mitä systemaattisesti geenimuuntelua vastustavat ajattelisivat, jos tietäisivät, että geenimuuntelussa ei ole mitään uutta. Luonto on tehnyt sitä aina. Ero on siinä, että kun luonto voi siirtää käärmeestä lehmään satunnaista ja potentiaalisesti vaarallista roinaa, ihminen ainakin yrittää siirtää jotain hyödyllistä; omalta kannaltaan hyödyllistä, ei muiden lajien, mutta kuitenkin.)

    Mikko Kolkkala

    • nopoles kirjoitti:

      Jatkoa edelliseen

      (Vastauksena kysymykseen ”Onko noin vain lehmän kohdalla vai onko muillakin ruohoa syövillä pätkä käärmeen DNA:a?”)

      Ei vain pätkä, vaan neljäsosa perimästä! Sadat miljoonat nukleotidit hujan hajan ympäri lehmän perimää ovat tuon tutkimuksen mukaan alunperin lähtöisin käärmeen perimästä.

      Saman retrotransposonin kopioita havaittiin suuria määriä lehmän lisäksi kaikkien muidenkin tutkittujen märehtijöiden perimästä – ja lisäksi vaihtelevia määriä satunnaisen tuntuisesti ympäri muuta eläinkuntaa. Niitä löydettiin esimerkiksi norsujen ja pussieläinten, mutta ei esimerkiksi sikojen tai lintujen perimästä – katso tarkemmin sukupuusta (kuvassa on siis retrotransposonien sukupuu, ei niiden isäntäeliöiden sukupuu).

      Vaikka lehmään siirtyneen dna:n alkuperä on käärmeen dna:ssa, kyseessä ei siis ole mikään varsinainen käärmeen oma geeni tai muu sellainen dna, mistä olisi käärmeille tai muille eliöille lähtökohtaisesti mitään käyttöä.*

      Evoluutio on kuitenkin opportunistista; sitten kun nurkat ovat jo jotain roinaa täynnä, niin kyllähän siihen luonnonvalinta tarttuu, jos tuosta roinasta on sitten joskus jotain hyötyäkin. Siteeraan tähän vielä aiemmin käsiteltyä pallokalajuttuani:

      ”[…] Luonnonvalinta on liian heikko pysyäkseen vauhdilla kopioituvien retroelementtien tahdissa, retroelementit ehtivät kopioitua kymmeniä tai satoja tuhansia kertoja ennen kuin niistä alkaa olla todellista haittaa.

      Onko retroelementeistä hyötyä? On. Ylimääräinen dna ei ole pelkkä haitta. Se antaa myös pelivaraa ja joustavuutta perimään. Perimän dna-palikoita voi silloin sekoitella, monistaa, käännellä ja yhdistellä vapaammin pelkäämättä, että jotain tärkeää menee rikki. Retroelementtien invaasion sanominen hyödylliseksi on kuitenkin vähän jälkiviisautta. Luonnonvalinta toimii tässä ja nyt, sillä ei voi olla pitkän tähtäimen suunnitelmia tyyliin: ’antaa nyt tämän joutavan dna-pätkän monistua hullun lailla siltä varalta, että muutaman miljoonan vuoden päästä tapahtuu jotain hyödyllistä’.

      * Retrotransposoneissa (pitkissä versioissa e.g. linet eli long interspersed nuclear elements) on kyllä niille itselle välttämättömiä geenejä. Olennainen niistä on rna:ta dna:ksi ”vastavirtaan” kääntävä käänteiskopiointientsyymin geeni (reverse transcriptase). Ihmisen perimässäkin on isoja määriä retrotransposoneja ja niiden mukana tulleita käänteiskopiointigeenin kopioita. Suurin osa näistä kopioista on tietenkin toimimattomia pseudogeenejä. En ole kuullut, että oman perimän käänteiskopiointigeeneistä olisi havaittu olevan ihmiselle hyötyä, haittaa niistä on havaittu.

      -Mikko

  5. nopoles kirjoitti:

    How come there are so ridiculously many copies of related retrotransposons in ruminant and in squamata genomes, and only moderate numbers in some other genomes? Here is my (rather technical…) hypothesis:

    Ruminant genomes, and only them, contain massive amounts of SINEs which include a short sequence called BovA as part of those SINEs. The main types of ruminant SINEs are BovtA which contains a rRNA related part attached into a BovA part, and BovA2 which is a dimer containing two BovA:s attached into each other with a 27 bp long linker sequence between them.

    It is possible that BovA sequence alone is a SINE itself, though it is not an effective disperser. (I found three clearcut BovA elements from Bos taurus genome and two of them contained hallmarks of retrotransposition, so called direct repeats and microsatellite tails [genbank accession numbers U30308 and X51355]).

    The BovA parts of BovtA, BovA2 SINEs and BovB LINE all formed clearly monophyletic groups in my phylogenetic analyses. In addition, the two BovA monomers of BovA2 dimer both formed a monophyletic group in the phylogenetic trees.

    The BovA parts of BovtA SINEs have accumulated more mutations in than those of BovA2 or BovB. Thus, BovtA is supposedly the oldest within genome disperser of these elements. The BovA parts of BovA2 are clearly more uniform than those of BovtA.

    BovA parts of BovB LINEs have accumulated less mutations than BovA parts of SINEs. This is suprising, because it has been supposed that BovtA and BovA2 sines are truncated versions of BovB, and thus BovB should be the oldest and the most variable element.

    I think that it could be on the other way around: BovA containing SINEs dispersed first in the genome of an ancient ruminant, and only after that some BovB LINE hit right in the middle of a BovA containing SINE, and that might have been the origin of explosive copying ability of this element in ruminants.

    Surprisingly BovB LINEs were found, in addition to ruminants, also from some snake and lizzard genomes (Kordis and Gubensek 1995 and 1998) and later from wide range of highly unrelated taxa marsupials, monotremes, African mammals and even from zebrafish, sea urchin and silkworm. Interestingly, BovB was revealed also from genomes of two tick species that might serve as vector for horizontal transfer of this retrotransposon from squamates to ruminants and some other mammal groups (Walsh 2013).

    Another SINE, Chicken Repeat 1 (CR1) might be responsible for high copy numbers of BovB LINE in squamates in same way as BovA is possibly responsible for abundancy of BovB in ruminant genomes. BovA is a unique sequence of ruminants. The BovB LINEs of other taxa do not contain BovA related parts typical to ruminant BovB. (There is one exception in gene bank * but I believe it is due to a sequencing error.)

    The origin of BovA element is unknown. tRNA related parts may activate copying processes of SINEs because they contain internal promoters for DNA polymerase III. BovA is not supposed to derive from a tRNA related sequence.

    However, when I compared the tRNA related part and BovA parts of BovtA SINEs (consensus of many sequences), I found that they resemble each other much more than random sequences (alignment below).

    1 ……………………….gggcttccctggtggctcagat 22

    ||| ||||| | || ||

    1 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccat 50

    23 ggtaaagaatctgcctgcaatgcaggagacc.tgggttcg..atccctgg 69

    || | || | ||||| | || || || |||| ||| | | |

    51 gg.acag.aggagcctggtaggctacagtccatggggtcgcaaagagtcg 98

    70 g..ttgggaagatcccct. tRNA related part

    | || || | ||

    99 gacatgact.gaagcgacta BovA part

    In addition, I found that predicted secondary structures of BovA sequences resembled the cloverleaf-like shape of tRNA molecules. Free BovA like RNA clearly would pair with itself effectively because it contains long so called palindrome sequence (underlined in the alignment). In this way BovA related RNA molecules themselves might serve as templates for reverse transcriptase enzymes (which are supposedly coded by BovB LINEs).

    Mikko Kolkkala [mikko.kolkkala (at) alumni.helsinki.fi]

    References

    Kordis, D. and Gubensek, F. 1995: Horizontal SINE transfer between vertebrate classes. Nature Genet. 10:131-132.

    Kordis, D. and Gubensek, F. 1998: Unusual horizontal transfer of a long interspersed nuclear element between distant vertebrate classes. Proc. Nat. Acad. Sci. 95: 10704–10709

    Walsh, A. M., Kortschak, R. D., Gardner, M. G., Bertozzi, T. and Adelson, D. L. 2013: Widespread horizontal transfer of retrotransposons. Proc. Natl. Acad. Sci. 110: 1012-1016

Vastaa

Täytä tietosi alle tai klikkaa kuvaketta kirjautuaksesi sisään:

WordPress.com-logo

Olet kommentoimassa WordPress.com -tilin nimissä. Log Out / Muuta )

Twitter-kuva

Olet kommentoimassa Twitter -tilin nimissä. Log Out / Muuta )

Facebook-kuva

Olet kommentoimassa Facebook -tilin nimissä. Log Out / Muuta )

Google+ photo

Olet kommentoimassa Google+ -tilin nimissä. Log Out / Muuta )

Muodostetaan yhteyttä palveluun %s

%d bloggers like this: